Sequence ID | >C131020766 |
Genome ID | HF558530 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Enterococcus faecalis str. Symbioflor 1 [HF558530] |
Start position on genome | 1877260 |
End posion on genome | 1877188 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
gacacgttaa |
tRNA gene sequence |
TGGAATATAGCTCAGTTGGTAGAGCATACGACTGTTAATCGTAGGGTCATGAGTTCGAGT |
Downstream region at tRNA end position |
gtggcataag |
Secondary structure (Cloverleaf model) | >C131020766 Asn GTT a Gtaa gtggcataag T - A G - C G - C A - T A - T T - A A - T T G T T G C T C A T G A A | + | | | G T C T C G A T G A G C G | | | | T T G G A G C T A A GGGTC T - A A - T C - G G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |