Sequence ID | >C133000221 |
Genome ID | CP003944 |
Search identical group | |
Phylum/Class | Cyanobacteriota |
Species | Dactylococcopsis salina PCC 8305 [CP003944] |
Start position on genome | 978619 |
End posion on genome | 978544 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
tgaacaacaa |
tRNA gene sequence |
GCCCCCATCGTCTAGAGGCCTAGGACACCTCCCTTTCACGGAGGCGACAGGGATTCGAAT |
Downstream region at tRNA end position |
aaaaaaagga |
Secondary structure (Cloverleaf model) | >C133000221 Glu TTC a ACTA aaaaaaagga G + T C - G C - G C - G C - G C - G A - T T A T T C C C T A A G A C | | | | | G G T C T G A G G G A C G + | | | T T C G G A C C T A A CGAC C - G C - G T - A C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |