Sequence ID | >C141008492 |
Genome ID | CP006778 |
Search identical group | |
Phylum/Class | Mycoplasmatota |
Species | Mesoplasma florum W37 [CP006778] |
Start position on genome | 628284 |
End posion on genome | 628208 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
attattaatt |
tRNA gene sequence |
GCCCATGTAGCTCAGTTGGATAGAGCACGCGCCTTCTAAGCGTGAGGTCGGAAGTTCGAG |
Downstream region at tRNA end position |
ctcgaaaaca |
Secondary structure (Cloverleaf model) | >C141008492 Arg TCT t ACCA ctcgaaaaca G - C C - G C - G C - G A - T T + G G - C C G T T C T T C A T G A A + | | | | G T C T C G G G A A G C G | | | | T T G G A G C A T A A AGGTC C - G G + T C - G G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |