Sequence ID | >C141012524 |
Genome ID | HF969015 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Salmonella enterica subsp. enterica serovar Bovismorbificans str. 3114 [HF969015] |
Start position on genome | 3997319 |
End posion on genome | 3997405 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
gttgtgaaac |
tRNA gene sequence |
GCGAAGGTGGCGGAATTGGTAGACGCGCTAGCTTCAGGTGTTAGTGTCCTTACGGACGTG |
Downstream region at tRNA end position |
cgactcaatg |
Secondary structure (Cloverleaf model) | >C141012524 Leu CAG c ACCA cgactcaatg G - C C - G G - C A - T A C G - C G - C T G T C C C C C A T A A G | | | | | A T G G C G G G G G G C G | | | T T G A C G C T A G G TGTCCTTACGGACGT C - G T - A A - T G + T C - G T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |