| Sequence ID | >C151005842 |
| Genome ID | CP004097 |
| Phylum/Class | Betaproteobacteria |
| Species | Burkholderia thailandensis 2002721723 [CP004097, CP004098] |
| Start position on genome | 1647783 |
| End posion on genome | 1647707 |
| Amino Acid | Pro |
| Anticodon | GGG |
| Upstream region at tRNA start position |
ttcacgcttt |
| tRNA gene sequence |
CGGGGCGTAGCGCAGCCTGGTAGCGTACCTGCATGGGGTGCAGGTGGTCGGAGGTTCAAA |
| Downstream region at tRNA end position |
ggaatcaagg |
| Secondary structure (Cloverleaf model) | >C151005842 Pro GGG
t ACCA ggaatcaagg
C - G
G - C
G - C
G - C
G - C
C - G
G - C T A
T T C T C C A
C G A A + | | | | A
C C G C G G G A G G C
T | | | + T T
G G C G T
G T A A TGGTC
C - G
C - G
T - A
G - C
C - G
A T
T G
G G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [Ensembl] |
| Comment | |
| --- | |
| Input Comment |