| Sequence ID | >C151017850 |
| Genome ID | CP007165 |
| Phylum/Class | Bacillota |
| Species | Bacillus velezensis NJN-6 [CP007165] |
| Start position on genome | 511971 |
| End posion on genome | 512045 |
| Amino Acid | Glu |
| Anticodon | TTC |
| Upstream region at tRNA start position |
tcaaccagac |
| tRNA gene sequence |
GGCCCGTTGGTCAAGCGGTTAAGACACCGCCCTTTCACGGCGGTAACACGGGTTCGAATC |
| Downstream region at tRNA end position |
tttaccttcg |
| Secondary structure (Cloverleaf model) | >C151017850 Glu TTC
c ACCA tttaccttcg
G - C
G + T
C - G
C - G
C - G
G - C
T - A T A
T T G C C C A
C G A G | | | | | G
G A C T G A C G G G C
G | | | T T
T A G A C
T A A TAAC
C - G
C - G
G - C
C - G
C - G
C C
T A
T T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [Ensembl] |
| Comment | |
| --- | |
| Input Comment |