Sequence ID | >C151019766 |
Genome ID | CP007245 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120008 [CP007245] |
Start position on genome | 3257664 |
End posion on genome | 3257739 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ccaccgccac |
tRNA gene sequence |
GGCCCCTTAGCTCAGTGGTTAGAGCAGGCGACTCATAATCGCTTGGTCGCTGGTTCAAGT |
Downstream region at tRNA end position |
aattttagct |
Secondary structure (Cloverleaf model) | >C151019766 Met CAT c ACCA aattttagct G - C G - C C - G C - G C - G C - G T - A T G T C G A C C A T G A A | | | | | A G C T C G G C T G G C G | | | | T T T G A G C T A A TGGTC G + T G - C C - G G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |