Sequence ID | >C151039118 |
Genome ID | CP008884 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Dyella japonica A8 [CP008884] |
Start position on genome | 496382 |
End posion on genome | 496307 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
cggcacgcat |
tRNA gene sequence |
GGGCCTATAGCTCAACGGTTAGAGCAGGGGACTCATAATCCCTTGGTTCCAGGTTCGAAT |
Downstream region at tRNA end position |
tcaatttgcg |
Secondary structure (Cloverleaf model) | >C151039118 Met CAT t ACCA tcaatttgcg G - C G - C G - C C - G C - G T + G A - T T A T G G T C C A C A A A | | | | | G G C T C G C C A G G C G | | | | T T T G A G C T A A TGGTT G + T G - C G - C G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |