| Sequence ID | >C151040567 |
| Genome ID | CP008934 |
| Phylum/Class | Bacillota |
| Species | Geobacillus stearothermophilus 10 [CP008934] |
| Start position on genome | 2323311 |
| End posion on genome | 2323386 |
| Amino Acid | Val |
| Anticodon | TAC |
| Upstream region at tRNA start position |
gcgatttcgt |
| tRNA gene sequence |
GGAGGATTAGCTCAGCTGGGAGAGCACTTGCCTTACAAGCAAGGGGTCGGCGGTTCGATC |
| Downstream region at tRNA end position |
tgttaatata |
| Secondary structure (Cloverleaf model) | >C151040567 Val TAC
t ACCA tgttaatata
G - C
G - C
A - T
G - C
G - C
A - T
T - A C T
T C T G C C A
C G A A | + | | | G
T C T C G G G C G G C
G | | | | T T
G G A G C
G A A GGGTC
C - G
T - A
T - A
G - C
C - G
C A
T A
T A C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |