Sequence ID | >C151040889 |
Genome ID | CP008957 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Escherichia coli O157:H7 str. EDL933 [CP008957] |
Start position on genome | 232258 |
End posion on genome | 232334 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
agaattcggt |
tRNA gene sequence |
GGAGCGGTAGTTCAGTCGGTTAGAATACCTGCCTGTCACGCAGGGGGTCGCGGGTTCGAG |
Downstream region at tRNA end position |
cttattaaga |
Secondary structure (Cloverleaf model) | >C151040889 Asp GTC t GCCA cttattaaga G - C G - C A - T G + T C - G G - C G - C T G T T G C C C A T G A A + | | | | G C C T T G G C G G G C G | | | + T T G G A A T T T A A GGGTC C - G C - G T - A G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |