Sequence ID | >C151043401 |
Genome ID | CP009090 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Salmonella enterica subsp. enterica serovar Enteritidis OLF-SE8-1021710 [CP009090] |
Start position on genome | 3336058 |
End posion on genome | 3335972 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
cagtatccgt |
tRNA gene sequence |
GCCGAGGTGGTGGAATTGGTAGACACGCTACCTTGAGGTGGTAGTGCCCAATAGGGCTTA |
Downstream region at tRNA end position |
atattccagg |
Secondary structure (Cloverleaf model) | >C151043401 Leu GAG t ACCA atattccagg G + T C - G C - G G - C A - T G - C G - C T G T T G C C C A T A A G | | | | | A T G G T G A C G G G C G | | | T T G A C A C T A G G TGCCCAATAGGGCTT C - G T - A A - T C - G C - G T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |