| Sequence ID | >C151051486 |
| Genome ID | CP009452 |
| Phylum/Class | Alphaproteobacteria |
| Species | Sphingopyxis sp. 113P3 [CP009452] |
| Start position on genome | 155447 |
| End posion on genome | 155522 |
| Amino Acid | Ala |
| Anticodon | TGC |
| Upstream region at tRNA start position |
gcatggtttg |
| tRNA gene sequence |
GGGGCCTTAGCTCAGCTGGGAGAGCACCTGCTTTGCAAGCAGGGGGTCATCGGTTCGATC |
| Downstream region at tRNA end position |
tccatgacgt |
| Secondary structure (Cloverleaf model) | >C151051486 Ala TGC
g ACCA tccatgacgt
G - C
G - C
G + T
G - C
C - G
C - G
T - A C T
T T A G C C A
C G A A | | | | | G
T C T C G A T C G G C
G | | | | T T
G G A G C
G A A GGGTC
C - G
C - G
T - A
G - C
C - G
T A
T A
T G C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |