Sequence ID | >C151051487 |
Genome ID | CP009452 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Sphingopyxis sp. 113P3 [CP009452] |
Start position on genome | 158907 |
End posion on genome | 158983 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
agctggttga |
tRNA gene sequence |
CGCGGGATGGAGCAGCCCGGTAGCTCGTCAGGCTCATAACCTGAAGGTCGCAGGTTCAAA |
Downstream region at tRNA end position |
acttaatttg |
Secondary structure (Cloverleaf model) | >C151051487 Met CAT a ACCA acttaatttg C A G - C C - G G - C G - C G - C A - T T A T C G T C C A C G A G | | | | | A C C G A G G C A G G C C | | | | T T G G C T C G T A G AGGTC T - A C - G A - T G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |