Sequence ID | >C151054246 |
Genome ID | CP009561 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Salmonella enterica subsp. enterica serovar Newport str. CVM N18486 [CP009561] |
Start position on genome | 554850 |
End posion on genome | 554774 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
acgtttcagg |
tRNA gene sequence |
CGCGGGGTGGAGCAGCCTGGTAGCTCGTCGGGCTCATAACCCGAAGGTCGTCGGTTCAAA |
Downstream region at tRNA end position |
ctttccctta |
Secondary structure (Cloverleaf model) | >C151054246 Met CAT g ACCA ctttccctta C A G - C C - G G - C G - C G - C G - C T A T C G G C C A C G A G | + | | | A C C G A G G T C G G C T | | | | T T G G C T C G T A G AGGTC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |