| Sequence ID | >C151067068 |
| Genome ID | CP010341 |
| Phylum/Class | Actinomycetota |
| Species | Propionibacterium freudenreichii subsp. freudenreichii DSM 20271 [CP010341] |
| Start position on genome | 2083223 |
| End posion on genome | 2083149 |
| Amino Acid | Pro |
| Anticodon | CGG |
| Upstream region at tRNA start position |
ctgtcagctt |
| tRNA gene sequence |
CGGGGTGTGGCGCAGCTTGGTAGCGCGCTTCGTTCGGGACGAAGAGGTCGCAGGTTCAAA |
| Downstream region at tRNA end position |
atggtgaagg |
| Secondary structure (Cloverleaf model) | >C151067068 Pro CGG
t ACag atggtgaagg
C - G
G - C
G - C
G - C
G - C
T - A
G - C T A
T T G T C C A
C G A G + | | | | A
T C G C G G C A G G C
T | | | | T T
G G C G C
G T A G AGGTC
C - G
T - A
T - A
C - G
G - C
T A
T G
C G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [Ensembl] |
| Comment | |
| --- | |
| Input Comment |