Sequence ID | >C151071324 |
Genome ID | CP010556 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Bacillus velezensis L-H15 [CP010556] |
Start position on genome | 557581 |
End posion on genome | 557654 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
caattcaaac |
tRNA gene sequence |
GCGGGTGTAGTTTAGTGGTAAAACCTCAGCCTTCCAAGCTGATGTCGTGAGTTCGATTCT |
Downstream region at tRNA end position |
ttataatgat |
Secondary structure (Cloverleaf model) | >C151071324 Gly TCC c TCCA ttataatgat G - C C - G G - C G - C G - C T - A G - C T T T T A C T C A G A A + | | | | G T T T T G G T G A G C G | | | | T T G A A A C T A C TGTC T - A C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |