Sequence ID | >C151073614 |
Genome ID | CP010873 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Mycobacterium tuberculosis Beijing-like [CP010873] |
Start position on genome | 729653 |
End posion on genome | 729726 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
cgggtgagcg |
tRNA gene sequence |
GCCCCCTTAGCTCAGTCGGCAGAGCGTTTCCATGGTAAGGAAAAGGTCAACGGTTCGATT |
Downstream region at tRNA end position |
cggacgccgg |
Secondary structure (Cloverleaf model) | >C151073614 Thr GGT g TCgg cggacgccgg G - C C - G C - G C - G C - G C - G T - A T T T T T G C C A T G A A | | | | | G C C T C G A A C G G C G | | | | T T G G A G C C A G AGGTC T - A T - A T - A C - G C - G A A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |