| Sequence ID | >C151075442 |
| Genome ID | CP011018 |
| Phylum/Class | Gammaproteobacteria |
| Species | Escherichia coli CI5 [CP011018] |
| Start position on genome | 3259318 |
| End posion on genome | 3259242 |
| Amino Acid | Arg |
| Anticodon | CCG |
| Upstream region at tRNA start position |
acggcgctaa |
| tRNA gene sequence |
GCGCCCGTAGCTCAGCTGGATAGAGCGCTGCCCTCCGGAGGCAGAGGTCTCAGGTTCGAA |
| Downstream region at tRNA end position |
tttagtcccg |
| Secondary structure (Cloverleaf model) | >C151075442 Arg CCG
a GCCA tttagtcccg
G - C
C - G
G - C
C - G
C - G
C - G
G - C T A
T T G T C C A
C G A A | | | | G
T C T C G T C A G G C
G | | | | T T
G G A G C
A T A G AGGTC
C - G
T - A
G - C
C - G
C - G
C A
T G
C C G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [Ensembl] |
| Comment | |
| --- | |
| Input Comment |