Sequence ID | >C151080797 |
Genome ID | CP011341 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Rhodococcus aetherivorans IcdP1 [CP011341] |
Start position on genome | 1155918 |
End posion on genome | 1155991 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
aatccggcgg |
tRNA gene sequence |
GCCCCCTTCGTCTAGCGGCCTAGGACGCCGCCCTTTCAAGGCGGTAGCGCGGGTTCGAAT |
Downstream region at tRNA end position |
ttgcggaagc |
Secondary structure (Cloverleaf model) | >C151080797 Glu TTC g ACgc ttgcggaagc G + T C - G C - G C - G C - G C - G T - A T A T T G C C C A C G A C + | | | | G G T C T G G C G G G C G + | | | T T C G G A C C T A G TAGC C - G C - G G - C C - G C - G C A T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |