Sequence ID | >C151084876 |
Genome ID | CP011581 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Enterobacter hormaechei CAV1411 [CP011581] |
Start position on genome | 4390051 |
End posion on genome | 4389976 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
tgactacgat |
tRNA gene sequence |
GGGGCTATAGCTCAGCTGGGAGAGCGCCTGCCTTGCACGCAGGAGGTCTGCGGTTCGATC |
Downstream region at tRNA end position |
tcttttactg |
Secondary structure (Cloverleaf model) | >C151084876 Ala TGC t ACCA tcttttactg G - C G - C G + T G - C C - G T - A A - T C T T A C G C C A C G A A | | | | | G T C T C G T G C G G C G | | | | T T G G A G C G A G AGGTC C - G C - G T - A G - C C - G C C T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |