| Sequence ID | >C151085243 |
| Genome ID | CP011602 |
| Phylum/Class | Gammaproteobacteria |
| Species | Phytobacter ursingii CAV1151 [CP011602] |
| Start position on genome | 1463478 |
| End posion on genome | 1463402 |
| Amino Acid | Val |
| Anticodon | GAC |
| Upstream region at tRNA start position |
gcacaacaat |
| tRNA gene sequence |
GCGTTCATAGCTCAGTTGGTTAGAGCACCACCTTGACATGGTGGGGGTCGTTGGTTCGAG |
| Downstream region at tRNA end position |
tctctttagt |
| Secondary structure (Cloverleaf model) | >C151085243 Val GAC
t ACCA tctctttagt
G - C
C - G
G - C
T - A
T - A
C - G
A - T T G
T T A A C C A
T G A A + | | | | G
T C T C G G T T G G C
G | | | | T T
G G A G C
T T A A GGGTC
C - G
C - G
A - T
C - G
C - G
T T
T A
G A C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [Ensembl] |
| Comment | |
| --- | |
| Input Comment |