| Sequence ID | >C151089635 |
| Genome ID | CP012024 |
| Phylum/Class | Bacillota |
| Species | Bacillus smithii DSM 4216 [CP012024] |
| Start position on genome | 744974 |
| End posion on genome | 745048 |
| Amino Acid | Gly |
| Anticodon | GCC |
| Upstream region at tRNA start position |
agcccagtac |
| tRNA gene sequence |
GCGGAAGTAGTTCAGTGGTAGAACACCACCTTGCCAAGGTGGGGGTCGCGGGTTCGAGTC |
| Downstream region at tRNA end position |
atgaaggcgg |
| Secondary structure (Cloverleaf model) | >C151089635 Gly GCC
c TCCA atgaaggcgg
G - C
C - G
G - C
G - C
A - T
A - T
G - C T G
T T G C C C A
G A A + | | | | G
T C T T G G C G G G C
G | | | | T T
G G A A C
T A A GGGTC
C - G
C - G
A - T
C - G
C - G
T A
T A
G C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [Ensembl] |
| Comment | |
| --- | |
| Input Comment |