Sequence ID | >C151092225 |
Genome ID | CP012165 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Enterobacter hormaechei subsp. xiangfangensis 34978 [CP012165] |
Start position on genome | 791387 |
End posion on genome | 791301 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
tcgatggtat |
tRNA gene sequence |
GCGAAGGTGGCGGAATTGGTAGACGCGCTAGCTTCAGGTGTTAGTGTCCTTACGGACGTG |
Downstream region at tRNA end position |
taaatcacgt |
Secondary structure (Cloverleaf model) | >C151092225 Leu CAG t ACCA taaatcacgt G - C C - G G - C A - T A C G - C G - C T G T C C C C C A T A A G | | | | | A T G G C G G G G G G C G | | | T T G A C G C T A G G TGTCCTTACGGACGT C - G T - A A - T G + T C - G T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |