| Sequence ID | >C151092944 |
| Genome ID | CP012259 |
| Phylum/Class | Gammaproteobacteria |
| Species | Cronobacter malonaticus [CP012259] |
| Start position on genome | 4054590 |
| End posion on genome | 4054515 |
| Amino Acid | Trp |
| Anticodon | CCA |
| Upstream region at tRNA start position |
caccctattt |
| tRNA gene sequence |
AGGGGCGTAGTTCAATTGGTAGAGCACCGGTCTCCAAAACCGGGTGTTGGGGGTTCGAGT |
| Downstream region at tRNA end position |
gaaattatcc |
| Secondary structure (Cloverleaf model) | >C151092944 Trp CCA
t GCCA gaaattatcc
A - T
G - C
G - C
G - C
G - C
C - G
G - C T G
T C T C C C A
T A A A | + | | | G
T C T T G G G G G G C
G | | + | T T
G G A G C
T A A GTGTT
C - G
C - G
G - C
G - C
T - A
C A
T A
C C A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |