Sequence ID | >C151099674 |
Genome ID | HE774679 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Bacillus velezensis YAU B9601-Y2 [HE774679] |
Start position on genome | 865885 |
End posion on genome | 865958 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
gccaccattt |
tRNA gene sequence |
GCCGGTCTAGCTCAATTGGTAGAGCAACTGACTTGTAATCAGTAGGTTGGGGGTTCAAGT |
Downstream region at tRNA end position |
taaatgatgg |
Secondary structure (Cloverleaf model) | >C151099674 Thr TGT t ACtc taaatgatgg G - C C - G C - G G - C G - C T + G C - G T G T T C T C C A T A A A + | + | | A T C T C G G G G G G C G | | | | T T G G A G C T A A AGGTT A - T C - G T - A G - C A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |