Sequence ID | >C153000481 |
Genome ID | CP007690 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Staphylococcus aureus UA-S391_USA300 [CP007690] |
Start position on genome | 1996212 |
End posion on genome | 1996138 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
ccaggtttat |
tRNA gene sequence |
GCGGGAGTAGTTCAACTTTTAGAACACGTTCCTTCCCGGAACGAGGTATAGGTGCAAATC |
Downstream region at tRNA end position |
taatttaata |
Secondary structure (Cloverleaf model) | >C153000481 Gly TCC t TCCA taatttaata G - C C - G G - C G - C G + T A - T G - C T A T T A T C C A C A A A | | | | | A T C T T G A T A G G C T | | | | T G T G A A C T A A AGGT C - G G - C T - A T - A C - G C G T C T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |