Sequence ID | >C161001672 |
Genome ID | AP014854 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Blastochloris viridis DSM 133 [AP014854] |
Start position on genome | 955049 |
End posion on genome | 954973 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
aatacgccat |
tRNA gene sequence |
GGGCCTGTAGCTCAGGTGGTTAGAGCGCACCCCTGATAAGGGTGAGGTCGGACGTTCGAG |
Downstream region at tRNA end position |
tcccgtgcac |
Secondary structure (Cloverleaf model) | >C161001672 Ile GAT t ACCA tcccgtgcac G - C G - C G - C C - G C - G T - A G - C T G T C C T G C A G G A A | | | | | G T C T C G G G A C G C G | | | | T T G G A G C T T A G AGGTC C - G A - T C - G C - G C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |