Sequence ID | >C161002502 |
Genome ID | AP017295 |
Search identical group | |
Phylum/Class | Cyanobacteriota |
Species | Nostoc sp. NIES-3756 [AP017295] |
Start position on genome | 2280217 |
End posion on genome | 2280293 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
caaatatcaa |
tRNA gene sequence |
TGGGAAGTAGGCAAACAGGCAAAGCCGTCGCACTTTGAACGCGAAGTTTGAAGGTTCGAT |
Downstream region at tRNA end position |
aatatatact |
Secondary structure (Cloverleaf model) | >C161002502 Gln TTG a GCCT aatatatact T - A G - C G - C G - C A - T A - T G - C T T T C T T C C A C A A A | | | | | G A A C G G G A A G G C G | | | T T G A G C C C A A G AGTTT T - A C - G G - C C - G A C C A T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |