Sequence ID | >C161002514 |
Genome ID | AP017295 |
Search identical group | |
Phylum/Class | Cyanobacteriota |
Species | Nostoc sp. NIES-3756 [AP017295] |
Start position on genome | 5832223 |
End posion on genome | 5832296 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
taattctgac |
tRNA gene sequence |
CGGGGCGTAGCGCAGCTTGGTAGCGCGCCACTTTGGGGTAGTGGAGGTCGTGGGTTCGAA |
Downstream region at tRNA end position |
acgaagtcta |
Secondary structure (Cloverleaf model) | >C161002514 Pro GGG c Atta acgaagtcta C - G G - C G - C G + T G - C C - G G - C T A T C G C C C A C G A A | + | | | G T C G C G G T G G G C T | | | | T T G G C G C G T A G AGGTC C - G C - G A - T C - G T - A T T T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |