Sequence ID | >C161009312 |
Genome ID | CP007330 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120003 [CP007330] |
Start position on genome | 1893049 |
End posion on genome | 1892973 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
aatttttctt |
tRNA gene sequence |
CCGCCATTAGCTCAACCGGATAGAGCATAGAGCTTCTACCTCTAAGGTTCGGGGTTCAAT |
Downstream region at tRNA end position |
gttgatatca |
Secondary structure (Cloverleaf model) | >C161009312 Arg TCT t ACCA gttgatatca C - G C - G G - C C - G C - G A - T T - A T T T G C T C C A C A A A | | + | | A C C T C G C G G G G C G | | | | T T G G A G C A T A A AGGTT T - A A - T G - C A - T G - C C C T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |