| Sequence ID | >C161014536 |
| Genome ID | CP007403 |
| Phylum/Class | Gammaproteobacteria |
| Species | Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120773 [CP007403] |
| Start position on genome | 1905488 |
| End posion on genome | 1905412 |
| Amino Acid | Arg |
| Anticodon | CCT |
| Upstream region at tRNA start position |
aagtccccag |
| tRNA gene sequence |
CCGCCACTAGCTCAGCTGGATAGAGCATCAACCTCCTAAGTTGATGGTGCGAGGTTCGAG |
| Downstream region at tRNA end position |
atgtggttat |
| Secondary structure (Cloverleaf model) | >C161014536 Arg CCT
g TCCA atgtggttat
C - G
C - G
G - C
C - G
C - G
A - T
C - G G G
T G C T C C A
C G A A | | | | | G
T C T C G C G A G G C
G | | | | T T
G G A G C
A T A A TGGTG
T - A
C - G
A - T
A - T
C - G
C A
T A
C C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |