| Sequence ID | >C161015750 |
| Genome ID | CP007423 |
| Phylum/Class | Gammaproteobacteria |
| Species | Salmonella enterica subsp. enterica serovar Enteritidis str. EC20130347 [CP007423] |
| Start position on genome | 4232337 |
| End posion on genome | 4232421 |
| Amino Acid | Tyr |
| Anticodon | GTA |
| Upstream region at tRNA start position |
catcaagtcc |
| tRNA gene sequence |
GGTGGGGTTCCCGAGCGGCCAAAGGGAGCAGACTGTAAATCTGCCGTCACAGACTTCGAA |
| Downstream region at tRNA end position |
ttttcggccg |
| Secondary structure (Cloverleaf model) | >C161015750 Tyr GTA
c ACCA ttttcggccg
G - C
G - C
T - A
G - C
G - C
G - C
G - C T A
T C T T C C A
C G A T | | | | | G
G G C C C G A A G G C
G | | | T T
C A G G G
C A A A CGTCACAGACTTC
G - C
C - G
A - T
G - C
A - T
C A
T A
G T A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |