Sequence ID | >C161020886 |
Genome ID | CP008981 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Mycobacterium tuberculosis 0A029DS [CP008981] |
Start position on genome | 588814 |
End posion on genome | 588887 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
atcacttcat |
tRNA gene sequence |
GGGGCTATGGCGCAGCTGGTAGCGCACCACACTGGCAGTGTGGGGGTCAGGGGTTCGAGT |
Downstream region at tRNA end position |
aggatcccgg |
Secondary structure (Cloverleaf model) | >C161020886 Ala GGC t ACtc aggatcccgg G - C G - C G + T G - C C - G T - A A - T T G T T C C C C A C G A G | | | | | G T C G C G A G G G G C G | | | | T T G G C G C T A A GGGTC C - G C - G A - T C - G A - T C G T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |