| Sequence ID | >C161022685 |
| Genome ID | CP009942 |
| Phylum/Class | Betaproteobacteria |
| Species | Burkholderia mallei KC_1092 [CP009942, CP009943] |
| Start position on genome | 237712 |
| End posion on genome | 237788 |
| Amino Acid | Arg |
| Anticodon | ACG |
| Upstream region at tRNA start position |
acttctgcgt |
| tRNA gene sequence |
GCGGCTGTAGCTCAGTTGGATAGAGTACTTGGCTACGAACCAAGGGGTCGTGGGTTCGAA |
| Downstream region at tRNA end position |
ctttttcgag |
| Secondary structure (Cloverleaf model) | >C161022685 Arg ACG
t GCCA ctttttcgag
G - C
C - G
G - C
G - C
C - G
T - A
G - C T A
T C G T C C A
T G A A | + + | | G
T C T C G G T G G G C
G | | | + T T
G G A G T
A T A A GGGTC
C - G
T - A
T - A
G - C
G - C
C A
T A
A C G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [Ensembl] |
| Comment | |
| --- | |
| Input Comment |