Sequence ID | >C161033016 |
Genome ID | CP011257 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Ralstonia mannitolilytica SN83A39 [CP011257, CP011258] |
Start position on genome | 2825617 |
End posion on genome | 2825543 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
gcacaggtcc |
tRNA gene sequence |
CTCGCCGTAGCACAATGGATAGTGCACGCGCCTCCTAAGCGTGAGATACAGGTTCGATTC |
Downstream region at tRNA end position |
ctctgctaaa |
Secondary structure (Cloverleaf model) | >C161033016 Arg CCT c ACCA ctctgctaaa C - G T + G C - G G - C C - G C - G G - C T T T T G T C C A T A A A | | | | | G G C A C G A C A G G C G | | | | T T A G T G C T A A AGAT C - G G + T C - G G - C C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |