Sequence ID | >C161041929 |
Genome ID | CP012403 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Azospirillum thiophilum BV-S [CP012401, CP012402, CP012403, CP012404, CP012405, CP012406, CP012407, CP012408] |
Start position on genome | 871608 |
End posion on genome | 871684 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
cacaagcgat |
tRNA gene sequence |
GGACCCGTAGCTCAGCTGGATAGAGCGCTGCCCTCCGAAGGCAGAGGCCGATGGTTCGAA |
Downstream region at tRNA end position |
agtttttcaa |
Secondary structure (Cloverleaf model) | >C161041929 Arg CCG t GCCA agtttttcaa G - C G - C A - T C - G C - G C - G G - C T A T T T A C C A C G A A + | | | | G T C T C G G A T G G C G | | | | T T G G A G C A T A G AGGCC C - G T - A G - C C - G C - G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |