Sequence ID | >C161041934 |
Genome ID | CP012404 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Azospirillum thiophilum BV-S [CP012401, CP012402, CP012403, CP012404, CP012405, CP012406, CP012407, CP012408] |
Start position on genome | 648894 |
End posion on genome | 648969 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
ggcgccggat |
tRNA gene sequence |
GCCCAGGTAGCTCAGTTGGTAGAGCAGGGGACTGAAAATCCCCGTGTCGGCGGTTCGACT |
Downstream region at tRNA end position |
ttccttttca |
Secondary structure (Cloverleaf model) | >C161041934 Phe GAA t ACCA ttccttttca G - C C - G C - G C - G A - T G - C G - C T C T C T G C C A T G A A | + | | | G T C T C G G G C G G C G | | | | T T G G A G C T A A GTGTC G - C G - C G - C G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |