Sequence ID | >C161045176 |
Genome ID | CP012743 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Klebsiella pneumoniae subsp. pneumoniae TGH8 [CP012743] |
Start position on genome | 4388718 |
End posion on genome | 4388642 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
gaaattcggt |
tRNA gene sequence |
GGAGCGGTAGTTCAGTCGGTTAGAATACCTGCCTGTCACGCAGGGGGTCGCGGGTTCGAG |
Downstream region at tRNA end position |
ttgtattttt |
Secondary structure (Cloverleaf model) | >C161045176 Asp GTC t GCCA ttgtattttt G - C G - C A - T G + T C - G G - C G - C T G T T G C C C A T G A A + | | | | G C C T T G G C G G G C G | | | + T T G G A A T T T A A GGGTC C - G C - G T - A G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |