| Sequence ID | >C161071328 |
| Genome ID | CP014335 |
| Phylum/Class | Bacillota |
| Species | Geobacillus thermoleovorans KCTC 3570 [CP014335] |
| Start position on genome | 215540 |
| End posion on genome | 215615 |
| Amino Acid | Asp |
| Anticodon | GTC |
| Upstream region at tRNA start position |
cgcgatttgt |
| tRNA gene sequence |
GGTCCCGTAGTGTAGTGGTTAACATGCCTGCCTGTCACGCAGGAGATCGCGGGTTCGAGT |
| Downstream region at tRNA end position |
ttgcactaaa |
| Secondary structure (Cloverleaf model) | >C161071328 Asp GTC
t GCCA ttgcactaaa
G - C
G - C
T - A
C - G
C - G
C - G
G - C T G
T T G C C C A
T G A A + | | | | G
G T G T G G C G G G C
G | | | + T T
T A C A T
T A G AGATC
C - G
C - G
T - A
G - C
C - G
C C
T A
G T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |