Sequence ID | >C161080065 |
Genome ID | CP014959 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Mycobacteroides abscessus FLAC048 [CP014959] |
Start position on genome | 3475065 |
End posion on genome | 3474990 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
actaaacaat |
tRNA gene sequence |
GGGGCTATGGCGCAGCTGGTAGCGCACCACACTGGCAGTGTGGGGGTCAGGGGTTCGAGT |
Downstream region at tRNA end position |
taatcccagg |
Secondary structure (Cloverleaf model) | >C161080065 Ala GGC t ACCA taatcccagg G - C G - C G + T G - C C - G T - A A - T T G T T C C C C A C G A G | | | | | G T C G C G A G G G G C G | | | | T T G G C G C T A A GGGTC C - G C - G A - T C - G A - T C G T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |