| Sequence ID | >C161088471 |
| Genome ID | CP015436 |
| Phylum/Class | Bacillota |
| Species | Anoxybacillus sp. B7M1 b7m1 [CP015436] |
| Start position on genome | 3074618 |
| End posion on genome | 3074702 |
| Amino Acid | Leu |
| Anticodon | TAG |
| Upstream region at tRNA start position |
ctcacttttt |
| tRNA gene sequence |
GCGGGTGTGGCGGAATTGGCAGACGCACCAGACTTAGGATCTGGCGCCTCACGGCGTGGG |
| Downstream region at tRNA end position |
tataaagttt |
| Secondary structure (Cloverleaf model) | >C161088471 Leu TAG
t ACCA tataaagttt
G - C
C - G
G - C
G - C
G - C
T - A
G - C T G
T C T C C C A
T A A G | + | | | A
T G G C G G G G G G C
G | | | T T
G A C G C
C A G A CGCCTCACGGCGT
C - G
C - G
A - T
G - C
A - T
C A
T G
T A G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [Ensembl] |
| Comment | |
| --- | |
| Input Comment |