Sequence ID | >C161095100 |
Genome ID | CP016210 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Azoarcus olearius DQS-4 [CP016210] |
Start position on genome | 2972899 |
End posion on genome | 2972823 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ccttctccga |
tRNA gene sequence |
CGCGGGGTGGAGCAGTCTGGCAGCTCGTCGGGCTCATAACCCGAAGGTCGCAGGTTCAAA |
Downstream region at tRNA end position |
acacctcgag |
Secondary structure (Cloverleaf model) | >C161095100 Met CAT a ACCA acacctcgag C A G - C C - G G - C G - C G - C G - C T A T C G T C C A T G A G | | | | | A C C G A G G C A G G C T | | | | T T G G C T C G C A G AGGTC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |