Sequence ID | >C161106577 |
Genome ID | LN854573 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Pseudomonas sp. URMO17WK12:I11 [LN854573] |
Start position on genome | 2062993 |
End posion on genome | 2062917 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ccagctttgt |
tRNA gene sequence |
CGCGGGGTGGAGCAGTCTGGTAGCTCGTCGGGCTCATAACCCGAAGGTCGTCGGTTCAAA |
Downstream region at tRNA end position |
gtttaaggag |
Secondary structure (Cloverleaf model) | >C161106577 Met CAT t ACCA gtttaaggag C A G - C C - G G - C G - C G - C G - C T A T C G G C C A T G A G | + | | | A C C G A G G T C G G C T | | | | T T G G C T C G T A G AGGTC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |