Sequence ID | >C161107643 |
Genome ID | LN890522 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Salmonella enterica subsp. enterica serovar Weltevreden 2511STDY5712384 [LN890522] |
Start position on genome | 4362325 |
End posion on genome | 4362409 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
catcaagtcc |
tRNA gene sequence |
GGTGGGGTTCCCGAGCGGCCAAAGGGAGCAGACTGTAAATCTGCCGTCACAGACTTCGAA |
Downstream region at tRNA end position |
ttttcggccg |
Secondary structure (Cloverleaf model) | >C161107643 Tyr GTA c ACCA ttttcggccg G - C G - C T - A G - C G - C G - C G - C T A T C T T C C A C G A T | | | | | G G G C C C G A A G G C G | | | T T C A G G G C A A A CGTCACAGACTTC G - C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |