Sequence ID | >C171032821 |
Genome ID | CP014670 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Escherichia coli CFSAN004177 [CP014670] |
Start position on genome | 4877460 |
End posion on genome | 4877535 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tccggctccc |
tRNA gene sequence |
GGCCCTTTAGCTCAGTGGTGAGAGCGAGCGACTCATAATCGCCAGGTCGCTGGTTCAAAT |
Downstream region at tRNA end position |
tcacaaaccg |
Secondary structure (Cloverleaf model) | >C171032821 Met CAT c ACCA tcacaaaccg G - C G - C C - G C - G C - G T - A T - A T A T C G A C C A T G A A | | | | | A G C T C G G C T G G C G | | | | T T T G A G C G A G AGGTC A C G - C C - G G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |