Sequence ID | >C171037082 |
Genome ID | CP015222 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Bacillus subtilis HRBS-10TDI13 [CP015222] |
Start position on genome | 98858 |
End posion on genome | 98934 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
attatgtttt |
tRNA gene sequence |
GCGCCCGTAGCTCAATTGGATAGAGCGTTTGACTACGGATCAAAAGGTTAGGGGTTCGAC |
Downstream region at tRNA end position |
tatcttttaa |
Secondary structure (Cloverleaf model) | >C171037082 Arg ACG t GCCA tatcttttaa G - C C - G G - C C - G C - G C - G G - C T C T T C T C C A T A A A | | + | | G T C T C G A G G G G C G | | | | T T G G A G C A T A G AGGTT T - A T - A T - A G - C A - T C A T G A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |