Sequence ID | >C171042522 |
Genome ID | CP015898 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Lactococcus lactis subsp. lactis C10 [CP015898] |
Start position on genome | 1771940 |
End posion on genome | 1771857 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
tatattatca |
tRNA gene sequence |
GCTCGAATGGCGGAATTGGCAGACGCTGCGGACTTAAAATCCGTTGGTTATTAAACCGTG |
Downstream region at tRNA end position |
taaaaaagca |
Secondary structure (Cloverleaf model) | >C171042522 Leu TAA a Ataa taaaaaagca G - C C - G T - A C - G G + T A - T A - T T G T C T C C C A T A A G | | | | | A T G G C G G A G G G C G | | | T T G A C G C C A G T TGGTTATTAAACCGT G + T C - G G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |