Sequence ID | >C171063594 |
Genome ID | CP017562 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Paraburkholderia sprentiae WSM5005 [CP017561, CP017562] |
Start position on genome | 1337055 |
End posion on genome | 1337132 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
cgggcgagaT |
tRNA gene sequence |
GGGCCGTTAGCTCAGCTGGTAGAGCAGCGGACTTTTAATCCGTTGGTCACTGGTTCGAAT |
Downstream region at tRNA end position |
Acgcaacacg |
Secondary structure (Cloverleaf model) | >C171063594 Lys TTT T ACCC Acgcaacacg G + T G - C G - C C - G C - G G - C T - A T A T T G A C C A C G A A | | | | | G T C T C G A C T G G C G | | | | T T G G A G C T A A TGGTC G + T C - G G - C G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |