Sequence ID | >C171072491 |
Genome ID | CP018076 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Sulfitobacter alexandrii AM1-D1 [CP018076] |
Start position on genome | 3043622 |
End posion on genome | 3043696 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
gctcatcggc |
tRNA gene sequence |
GCTGCTGTAGCTCAGAGGTAGAGCACTCCCTTGGTAAGGGAGAGGTCGAGAGTTCAATTC |
Downstream region at tRNA end position |
tgttacttta |
Secondary structure (Cloverleaf model) | >C171072491 Thr GGT c ACCA tgttacttta G - C C - G T - A G - C C - G T - A G - C T T T C T C T C A G A A | | | | | A A C T C G G A G A G C G | | | | T T G G A G C T A A AGGTC C - G T - A C - G C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |