Sequence ID | >C171085866 |
Genome ID | CP018874 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Priestia megaterium JX285 [CP018874] |
Start position on genome | 407000 |
End posion on genome | 407083 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
cagttattgt |
tRNA gene sequence |
GGAGGGGTAGCGAAGTGGCTAAACGCGGCGGACTGTAAATCCGCTCCTTCGGGTTCGGCA |
Downstream region at tRNA end position |
tttacagggg |
Secondary structure (Cloverleaf model) | >C171085866 Tyr GTA t ACCA tttacagggg G - C G - C A - T G - C G - C G - C G - C T A T C C G T C A T G A A | | | | | G G A G C G G G C A G C G | | | T T C A C G C T A A G TCCTTCGGGTTC G - C C - G G - C G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |